ID: 1031845619_1031845622

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1031845619 1031845622
Species Human (GRCh38) Human (GRCh38)
Location 7:126802710-126802732 7:126802750-126802772
Sequence CCTATTTTCCTTAAGAGCTGCAG CTAGAAGCCATGCCACAAACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 178} {0: 1, 1: 0, 2: 0, 3: 9, 4: 147}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!