ID: 1031867503_1031867505

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1031867503 1031867505
Species Human (GRCh38) Human (GRCh38)
Location 7:127053965-127053987 7:127053987-127054009
Sequence CCTTACAGTAACTCTGAGAGGTA AGATACTTCTTAACTGGTATAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 7, 3: 77, 4: 442} {0: 1, 1: 0, 2: 1, 3: 7, 4: 151}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!