ID: 1031883882_1031883885 |
View in Genome Browser |
Spacer: 21 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1031883882 | 1031883885 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 7:127225474-127225496 | 7:127225518-127225540 |
| Sequence | CCTATCTGCTGGAAAAAAAAAAA | GAGAATGATCTGATGCAGCTAGG |
| Strand | - | + |
| Off-target summary | {0: 1, 1: 1, 2: 34, 3: 522, 4: 5196} | No data |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||