ID: 1031884574_1031884580 |
View in Genome Browser |
Spacer: 11 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1031884574 | 1031884580 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 7:127232491-127232513 | 7:127232525-127232547 |
| Sequence | CCATCCACCTTGGCCTCCCACAG | CAAGTGTGTGCAACCACACCTGG |
| Strand | - | + |
| Off-target summary | No data | {0: 1, 1: 110, 2: 2369, 3: 13644, 4: 47762} |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||