ID: 1031907251_1031907260

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1031907251 1031907260
Species Human (GRCh38) Human (GRCh38)
Location 7:127474428-127474450 7:127474472-127474494
Sequence CCTTCCCCCTACTTCTCTTTGAG AGACCAAAGTCAATGCAACTGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!