ID: 1031928521_1031928526

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1031928521 1031928526
Species Human (GRCh38) Human (GRCh38)
Location 7:127661459-127661481 7:127661491-127661513
Sequence CCTGAGGAGCTTCATCCCTAGGC CTCTCCTGTTTCTTATTCATAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 103} {0: 1, 1: 0, 2: 1, 3: 31, 4: 291}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!