ID: 1031943587_1031943596

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1031943587 1031943596
Species Human (GRCh38) Human (GRCh38)
Location 7:127815448-127815470 7:127815493-127815515
Sequence CCACTGGACTCTAGTCTGTGCAA AAGAAGAAGGAGGAGGAGGAGGG
Strand - +
Off-target summary No data {0: 36, 1: 155, 2: 521, 3: 2021, 4: 6837}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!