ID: 1031945136_1031945138 |
View in Genome Browser |
Spacer: 2 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1031945136 | 1031945138 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 7:127831649-127831671 | 7:127831674-127831696 |
| Sequence | CCGTGGCCTCAGTGTGGGAACTA | GTGATGAAACAGATGCTCAAAGG |
| Strand | - | + |
| Off-target summary | {0: 1, 1: 0, 2: 0, 3: 10, 4: 165} | No data |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||