ID: 1031959622_1031959631

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1031959622 1031959631
Species Human (GRCh38) Human (GRCh38)
Location 7:127976890-127976912 7:127976935-127976957
Sequence CCTTTGCTGGGACAGGCTCCACC GCTTCCCATTTCCTTCAGTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 161} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!