ID: 1031970060_1031970067

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1031970060 1031970067
Species Human (GRCh38) Human (GRCh38)
Location 7:128058120-128058142 7:128058133-128058155
Sequence CCTGACCCCTTGCCAGTGCTAGG CAGTGCTAGGCAAACAAGCTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 22, 4: 129}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!