ID: 1031972496_1031972501

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1031972496 1031972501
Species Human (GRCh38) Human (GRCh38)
Location 7:128074724-128074746 7:128074748-128074770
Sequence CCTCCCGTCCTCCTCACACACTA TGCTGCTGCCTCCAGAGAACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 299} {0: 1, 1: 0, 2: 4, 3: 38, 4: 367}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!