ID: 1032000064_1032000070

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1032000064 1032000070
Species Human (GRCh38) Human (GRCh38)
Location 7:128259485-128259507 7:128259517-128259539
Sequence CCCAGTCCTGCTGGGCCTCAGGT AAGCCAACTCCCCCCACCCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 50, 4: 364} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!