ID: 1032013411_1032013418

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1032013411 1032013418
Species Human (GRCh38) Human (GRCh38)
Location 7:128360970-128360992 7:128361017-128361039
Sequence CCCCTGCACGCGCGCGCGCACAC AGCCACTCTCCTCCCTGCATGGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 1, 3: 26, 4: 277}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!