ID: 1032016164_1032016167

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1032016164 1032016167
Species Human (GRCh38) Human (GRCh38)
Location 7:128381588-128381610 7:128381617-128381639
Sequence CCAGGCGGGGTCACTGCTGGTTG GAGTGAAGTCATGTCTTTGAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 4, 3: 45, 4: 680}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!