ID: 1032017121_1032017127

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1032017121 1032017127
Species Human (GRCh38) Human (GRCh38)
Location 7:128387413-128387435 7:128387457-128387479
Sequence CCTCACAGGGCTTGGACACTTCA GAATGGACCCAAGGACATCCAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!