ID: 1032027563_1032027576

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1032027563 1032027576
Species Human (GRCh38) Human (GRCh38)
Location 7:128455785-128455807 7:128455832-128455854
Sequence CCCGGGCGTGCGTGCGGCCTCCA GGCGTGCTCGCGGCTATAAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 116} {0: 1, 1: 0, 2: 0, 3: 0, 4: 7}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!