ID: 1032027566_1032027581

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1032027566 1032027581
Species Human (GRCh38) Human (GRCh38)
Location 7:128455805-128455827 7:128455846-128455868
Sequence CCAGTGCGCGTGCGCGTACCCTC TATAAGGGGCGGAGGCTGGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 27} {0: 1, 1: 0, 2: 0, 3: 22, 4: 236}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!