ID: 1032059774_1032059788

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1032059774 1032059788
Species Human (GRCh38) Human (GRCh38)
Location 7:128714942-128714964 7:128714994-128715016
Sequence CCTGCAACTGCTTCCATAACCTG TGCTGCAAAGCTTAGGAAGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 179} {0: 1, 1: 0, 2: 0, 3: 24, 4: 175}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!