ID: 1032067634_1032067639

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1032067634 1032067639
Species Human (GRCh38) Human (GRCh38)
Location 7:128783519-128783541 7:128783557-128783579
Sequence CCCTACTTTTTCTGTCCCTTCTC ATACACTGCCTGCCCCTTCTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 17, 3: 138, 4: 1247} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!