ID: 1032079177_1032079183

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1032079177 1032079183
Species Human (GRCh38) Human (GRCh38)
Location 7:128850107-128850129 7:128850131-128850153
Sequence CCTCCTCCCCTTCCTTCATTTCT CTCTCTACTCCTCTGCAGCCAGG
Strand - +
Off-target summary {0: 1, 1: 4, 2: 68, 3: 922, 4: 6736} {0: 1, 1: 0, 2: 2, 3: 41, 4: 987}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!