ID: 1032080070_1032080081

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1032080070 1032080081
Species Human (GRCh38) Human (GRCh38)
Location 7:128854301-128854323 7:128854333-128854355
Sequence CCCGAAGGCCAGGGCAGGTCTGA GAGGTTTAACTGATGGGGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 35, 4: 321} {0: 1, 1: 0, 2: 0, 3: 38, 4: 419}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!