ID: 1032080737_1032080744

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1032080737 1032080744
Species Human (GRCh38) Human (GRCh38)
Location 7:128857257-128857279 7:128857288-128857310
Sequence CCCTGGCAACTACCTCATTGCCA GGTGGCCCCCAGCACATCGTGGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 15, 4: 168} {0: 2, 1: 0, 2: 1, 3: 6, 4: 92}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!