ID: 1032081290_1032081307 |
View in Genome Browser |
Spacer: 9 |
Left Crispr | Right Crispr | |
---|---|---|
Crispr ID | 1032081290 | 1032081307 |
Species | Human (GRCh38) | Human (GRCh38) |
Location | 7:128859789-128859811 | 7:128859821-128859843 |
Sequence | CCTGCCCTGGCCAGCTCCCTCCA | CCATGCTGCAGCTTGGCGGGGGG |
Strand | - | + |
Off-target summary | No data | No data |
Status | Not started |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer | Left Crispr | Right Crispr | ||||||
---|---|---|---|---|---|---|---|---|
Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
No off target data available for this pair! |