ID: 1032089957_1032089964

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1032089957 1032089964
Species Human (GRCh38) Human (GRCh38)
Location 7:128906564-128906586 7:128906589-128906611
Sequence CCTAGGAAACCATCTCTTCCAGG CCAGCACATTCCCCAGAGAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 295} {0: 1, 1: 0, 2: 0, 3: 58, 4: 270}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!