ID: 1032118183_1032118187

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1032118183 1032118187
Species Human (GRCh38) Human (GRCh38)
Location 7:129135253-129135275 7:129135268-129135290
Sequence CCAGTTTAGATCAGGACTTATCT ACTTATCTTCAGGGAGTGGATGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 7, 4: 153}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!