ID: 1032122009_1032122017

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1032122009 1032122017
Species Human (GRCh38) Human (GRCh38)
Location 7:129163433-129163455 7:129163476-129163498
Sequence CCTGCCTCCATCTCCTAAGTCTC ACCATGATTGGCTTAATAAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 113, 4: 1704} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!