ID: 1032131814_1032131817

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1032131814 1032131817
Species Human (GRCh38) Human (GRCh38)
Location 7:129235403-129235425 7:129235426-129235448
Sequence CCAGCCTCCTTCTCATTCTTCTT CTTCTTCTTTCTCTTGAGACAGG
Strand - +
Off-target summary No data {0: 1, 1: 3, 2: 49, 3: 484, 4: 3821}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!