ID: 1032131814_1032131818 |
View in Genome Browser |
Spacer: 1 |
Left Crispr | Right Crispr | |
---|---|---|
Crispr ID | 1032131814 | 1032131818 |
Species | Human (GRCh38) | Human (GRCh38) |
Location | 7:129235403-129235425 | 7:129235427-129235449 |
Sequence | CCAGCCTCCTTCTCATTCTTCTT | TTCTTCTTTCTCTTGAGACAGGG |
Strand | - | + |
Off-target summary | No data | {0: 1, 1: 6, 2: 171, 3: 1874, 4: 20047} |
Status | Not started |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer | Left Crispr | Right Crispr | ||||||
---|---|---|---|---|---|---|---|---|
Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
No off target data available for this pair! |