ID: 1032131814_1032131818

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1032131814 1032131818
Species Human (GRCh38) Human (GRCh38)
Location 7:129235403-129235425 7:129235427-129235449
Sequence CCAGCCTCCTTCTCATTCTTCTT TTCTTCTTTCTCTTGAGACAGGG
Strand - +
Off-target summary No data {0: 1, 1: 6, 2: 171, 3: 1874, 4: 20047}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!