ID: 1032131815_1032131819 |
View in Genome Browser |
Spacer: 16 |
Left Crispr | Right Crispr | |
---|---|---|
Crispr ID | 1032131815 | 1032131819 |
Species | Human (GRCh38) | Human (GRCh38) |
Location | 7:129235407-129235429 | 7:129235446-129235468 |
Sequence | CCTCCTTCTCATTCTTCTTCTTC | AGGGTCTCACTGTGTCACCCAGG |
Strand | - | + |
Off-target summary | {0: 5, 1: 54, 2: 649, 3: 2513, 4: 6435} | No data |
Status | Not started |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer | Left Crispr | Right Crispr | ||||||
---|---|---|---|---|---|---|---|---|
Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
No off target data available for this pair! |