ID: 1032131815_1032131819

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1032131815 1032131819
Species Human (GRCh38) Human (GRCh38)
Location 7:129235407-129235429 7:129235446-129235468
Sequence CCTCCTTCTCATTCTTCTTCTTC AGGGTCTCACTGTGTCACCCAGG
Strand - +
Off-target summary {0: 5, 1: 54, 2: 649, 3: 2513, 4: 6435} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!