ID: 1032148727_1032148732

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1032148727 1032148732
Species Human (GRCh38) Human (GRCh38)
Location 7:129408829-129408851 7:129408855-129408877
Sequence CCAGGAGAGATGTATCATGGAGT AGGGGTATAGAGTTTTAAGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 104} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!