ID: 1032153681_1032153688

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1032153681 1032153688
Species Human (GRCh38) Human (GRCh38)
Location 7:129451346-129451368 7:129451379-129451401
Sequence CCTTGAGGAAAGGCAGAAAGACA GGCTGTGTGTGGAGGACAGAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 5, 3: 70, 4: 644}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!