ID: 1032166303_1032166315

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1032166303 1032166315
Species Human (GRCh38) Human (GRCh38)
Location 7:129547733-129547755 7:129547776-129547798
Sequence CCTCCACCTTTTTGTTTCCTCTG ATGCCCATCCACATTGGTGACGG
Strand - +
Off-target summary No data {0: 8, 1: 33, 2: 132, 3: 324, 4: 752}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!