ID: 1032174586_1032174597

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1032174586 1032174597
Species Human (GRCh38) Human (GRCh38)
Location 7:129612399-129612421 7:129612436-129612458
Sequence CCTCCTGCCGGGGTGGCGTGGGC GACTGGGGGACGCTGGAATATGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 17, 4: 154}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!