ID: 1032222574_1032222581

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1032222574 1032222581
Species Human (GRCh38) Human (GRCh38)
Location 7:130005891-130005913 7:130005924-130005946
Sequence CCAGCTGCTTTCCCCTTCCACTG TCTGCCTTCTTCTTATCAAGAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!