ID: 1032268566_1032268578

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1032268566 1032268578
Species Human (GRCh38) Human (GRCh38)
Location 7:130384665-130384687 7:130384709-130384731
Sequence CCTCGAATGGCTCCTCACCACTG CTGCCCCTGCAGTGAGGGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 97} {0: 1, 1: 0, 2: 3, 3: 46, 4: 446}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!