ID: 1032274375_1032274387

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1032274375 1032274387
Species Human (GRCh38) Human (GRCh38)
Location 7:130441230-130441252 7:130441253-130441275
Sequence CCAGCCTTAGGGCGGGAAGAGAG GCGCGGGGGGAGGGGAAGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 140} {0: 1, 1: 0, 2: 9, 3: 175, 4: 1539}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!