ID: 1032299759_1032299770

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1032299759 1032299770
Species Human (GRCh38) Human (GRCh38)
Location 7:130675891-130675913 7:130675937-130675959
Sequence CCAGCCTATGAATTTTGCTTTGT CTCAACTAGGAGTGGGGACACGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 16, 4: 167}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!