ID: 1032328744_1032328747

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1032328744 1032328747
Species Human (GRCh38) Human (GRCh38)
Location 7:130957321-130957343 7:130957352-130957374
Sequence CCAGCAAGAGGGCTCAGGGTGGC CCCAGGCTGAAGCCTGCTAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 19, 4: 221} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!