ID: 1032344621_1032344634

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1032344621 1032344634
Species Human (GRCh38) Human (GRCh38)
Location 7:131106968-131106990 7:131107010-131107032
Sequence CCCTGCCGGAGAAAAGAGGGACG CAGGGAGTTGCTGATTCCAGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 22, 4: 223}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!