ID: 1032454203_1032454207

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1032454203 1032454207
Species Human (GRCh38) Human (GRCh38)
Location 7:132059509-132059531 7:132059540-132059562
Sequence CCTTGAGTGTCATAGGACACTCG GACTTGCACCCTGAGTGTTGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 8, 4: 113}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!