ID: 1032468528_1032468535

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1032468528 1032468535
Species Human (GRCh38) Human (GRCh38)
Location 7:132161830-132161852 7:132161851-132161873
Sequence CCAGGCTCCCACGTGGGTACCCA CAGTGCTCTAGTGGGCTTCTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 17, 4: 117} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!