ID: 1032483999_1032484018

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1032483999 1032484018
Species Human (GRCh38) Human (GRCh38)
Location 7:132269354-132269376 7:132269403-132269425
Sequence CCCCCTGCCTCCCCCGCCCCCAC TCTCCACAGCTCCACCAGACCGG
Strand - +
Off-target summary {0: 1, 1: 10, 2: 87, 3: 1834, 4: 12343} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!