ID: 1032484001_1032484018

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1032484001 1032484018
Species Human (GRCh38) Human (GRCh38)
Location 7:132269356-132269378 7:132269403-132269425
Sequence CCCTGCCTCCCCCGCCCCCACCA TCTCCACAGCTCCACCAGACCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 31, 3: 279, 4: 2174} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!