ID: 1032485530_1032485541

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1032485530 1032485541
Species Human (GRCh38) Human (GRCh38)
Location 7:132284544-132284566 7:132284582-132284604
Sequence CCAAAGGCCACGTCTCAGGGAAG TGTCCACTAGAACACCCAAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 31, 4: 198} {0: 1, 1: 0, 2: 0, 3: 11, 4: 81}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!