ID: 1032492190_1032492195

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1032492190 1032492195
Species Human (GRCh38) Human (GRCh38)
Location 7:132331912-132331934 7:132331941-132331963
Sequence CCCTTGAGTGTTGAGATCTGGGT CCCTGCTCAGATAAGGCATCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 148} {0: 1, 1: 0, 2: 2, 3: 13, 4: 140}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!