ID: 1032510245_1032510257

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1032510245 1032510257
Species Human (GRCh38) Human (GRCh38)
Location 7:132466586-132466608 7:132466607-132466629
Sequence CCCCATTGGGTCCAGCCCTCCCA CAAGATGCAAGGATGGAGGTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 22, 4: 368}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!