ID: 1032514607_1032514612

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1032514607 1032514612
Species Human (GRCh38) Human (GRCh38)
Location 7:132497396-132497418 7:132497423-132497445
Sequence CCTTGAGATGACATCGTGTTTAC CAATACCTCCTCAGGGGTAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 84} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!