ID: 1032519079_1032519086

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1032519079 1032519086
Species Human (GRCh38) Human (GRCh38)
Location 7:132529128-132529150 7:132529149-132529171
Sequence CCAGCAAAGCCAGCCCCAGTCCA CATAATAACCCCACCCTGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 295} {0: 1, 1: 0, 2: 2, 3: 4, 4: 91}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!