ID: 1032531601_1032531605

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1032531601 1032531605
Species Human (GRCh38) Human (GRCh38)
Location 7:132625269-132625291 7:132625288-132625310
Sequence CCCAGCACAGTGCTGGATCCTGA CTGAAGGAGCAGAATTATGAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 15, 4: 223}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!