ID: 1032534426_1032534429

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1032534426 1032534429
Species Human (GRCh38) Human (GRCh38)
Location 7:132650063-132650085 7:132650086-132650108
Sequence CCAACACCTGGGTCCAGCTGCTC TATTGAGCTGCCTTTGTTGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 30, 4: 304} {0: 1, 1: 0, 2: 0, 3: 14, 4: 129}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!